View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15271_high_4 (Length: 358)
Name: NF15271_high_4
Description: NF15271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15271_high_4 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 37870880 - 37870699
Alignment:
| Q |
1 |
tgtccgtatccgtgcttcatagatttcaacaaacttatgatttgatatccacagtttatttttcaatcagtggtttgtagtactcagtttactctctaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37870880 |
tgtccgtatccgtgcttcatagatttcaacaaacttatgatttgttatccacagtttatttttcaatcagtggtttgtagtactcagtttactctctaga |
37870781 |
T |
 |
| Q |
101 |
gtgtcttcttcactttagaggagtcagatccgagtcaactaccttgtacaccatccgctcacactaaatcagatccaatggt |
182 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
37870780 |
gtgtcttcttcacttcagaggagtcagatccgagtcaaccaccttgtacaccaaccactcacactaaatcagatccaatggt |
37870699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 260 - 341
Target Start/End: Complemental strand, 37870622 - 37870541
Alignment:
| Q |
260 |
ctttccgacatagaaagtacaaaataatgaaaagtcaacaacaacaacacactcacgaatgcatgcaaccacaaaacgaaag |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37870622 |
ctttccgacatagaaagtacaaaataatgaaaagtcaacaataacaacacactcacgaatgcatgcaaccacaaaacgaaag |
37870541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 71700 - 71667
Alignment:
| Q |
1 |
tgtccgtatccgtgcttcatagatttcaacaaac |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
71700 |
tgtccgtatccgtgcttcatagatctcaacaaac |
71667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University