View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15274_high_10 (Length: 244)
Name: NF15274_high_10
Description: NF15274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15274_high_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 54912357 - 54912131
Alignment:
| Q |
18 |
taaaggtcacattttggtttgacattttcaaagtaagttttgccatacaattcttataccactgccataatttttagcaccgagttttgtagtaacaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54912357 |
taaaggtcacattttggtttgacattttcaaagtaagttttgccatacaattcttataccactgccataatttttagcactgagttttgtagtaacaaaa |
54912258 |
T |
|
| Q |
118 |
gttttcaatttcgtttcagaatatagacaaaattcggtatgtcaactgtccggtgtttgttatacatgtaagtatgtctttctttccatctatgtatgta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54912257 |
gttttcaatttcgtttcagaatatagacaaaattcggtatgtcaaatgtccggtgtttgttatacatgtaagtatgtctttctttccatctatgtatgta |
54912158 |
T |
|
| Q |
218 |
atcagtttatgcaattgtgttcccttt |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54912157 |
atcagtttatgcaattgtgttcccttt |
54912131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University