View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15274_high_12 (Length: 239)
Name: NF15274_high_12
Description: NF15274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15274_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 45018626 - 45018508
Alignment:
| Q |
1 |
tttcttacatgtctcattgcatatgcatcctcccttcttgcatagggccttatatatagtccatgacatgttttcagttgttttgtgtgacacaatgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018626 |
tttcttacatgtctcattgcatatgcatcctcccttcttgcatagggccttata----gtccatgacatgttttcagttgttttgtgtgacacaatgtaa |
45018531 |
T |
|
| Q |
101 |
acattggaggattttccatgaac |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45018530 |
acattggaggattttccatgaac |
45018508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 45018507 - 45018464
Alignment:
| Q |
161 |
tctgaagcacaatgttgttgctctactttccttgtttttatttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018507 |
tctgaagcacaatgttgttgctctactttccttgtttttatttc |
45018464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Original strand, 3173127 - 3173169
Alignment:
| Q |
78 |
ttgttttgtgtgacacaatgtaaacattggaggattttccatg |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3173127 |
ttgttttgtgtgacacaatgtaaacggaggaggattttccatg |
3173169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University