View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15274_low_4 (Length: 359)
Name: NF15274_low_4
Description: NF15274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15274_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 53833923 - 53833783
Alignment:
| Q |
18 |
cagacatgatctttacaccttttcataataaattatacgttgcggttttattacatttcatttggatatgcttctttagtaatgtc--aaagaagcaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53833923 |
cagacatgatctttacaccttttcataataaattatacgttgcggttatattacatttcatttggatatgcttctttagtaatgtcaaaaagaagcaatc |
53833824 |
T |
 |
| Q |
116 |
tatttatcttttacaaagtagcaccaatctattattcattc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53833823 |
tatttatcttttacaaagtagcaccaatctattattcattc |
53833783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 204 - 346
Target Start/End: Complemental strand, 53833734 - 53833592
Alignment:
| Q |
204 |
caactaatatagtgttggaagagttgatattacttctcttatagaataacccgagtttgatttcagaagtcgttcattttaaagagaaaaagtgatttct |
303 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||||||||| |||||||||||| ||||||| |
|
|
| T |
53833734 |
caactaatttagtgtcggaagagttgatatcacttctcttatagaataacccaagttgaatttcaaaagtcgttcatttgaaagagaaaaagagatttct |
53833635 |
T |
 |
| Q |
304 |
tttctccgattcgaagattagtttcataacaaatcacctattc |
346 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53833634 |
tttctgcgattcgaagattaatttcataacaaatcacctattc |
53833592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University