View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15274_low_8 (Length: 254)

Name: NF15274_low_8
Description: NF15274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15274_low_8
NF15274_low_8
[»] chr5 (1 HSPs)
chr5 (141-240)||(40795918-40796016)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 141 - 240
Target Start/End: Complemental strand, 40796016 - 40795918
Alignment:
141 atttggcacttatttggtttgaagcaacactttagacttctaatgcatcgacacttttgaatgacgatttattttaagtatccaacatgtattgtctctg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||| ||||||| ||||    
40796016 atttggcacttatttggtttgaagcaacactttagacttctaatgcaccgacacttttgaatgacgatgtatttt-agtatccaacacgtattgtgtctg 40795918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University