View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15275_high_13 (Length: 211)
Name: NF15275_high_13
Description: NF15275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15275_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 38737155 - 38736973
Alignment:
| Q |
15 |
atgaaagatttgagatgatggatatcttattatggtcctattaggatgtcaatttgtatcttcatgtggagattttcgtaggagttgtcaaatttgagaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38737155 |
atgaaagatttgagatgatggatatcttattatggtcctattaggatgtcaatttgtatcttcatgtaaagattttcgtaggagttgtcaaatttgagaa |
38737056 |
T |
|
| Q |
115 |
accgcgaatgacagagattagcatcatacaccgccttgcatgaaccttgtcctctaatattttactaaaataacatttatact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38737055 |
accgcgaatgacagagattagcatcatacaccgccttgcatgaaccttgtcctctaacattttactaaaataacatttatact |
38736973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University