View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15275_high_9 (Length: 260)
Name: NF15275_high_9
Description: NF15275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15275_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 31132653 - 31132761
Alignment:
| Q |
10 |
cacagatgaataaatctgattttacaatataatgtaaggtggtgcattgcacccaaaagaaaatgtaaggacgtgtaggataatttagaaattttccttt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31132653 |
cacacatgaataaatctgattttacaatataatgtaaggtggtgaattgcacccaaaagaaaatgtgaggacgtgtaggataattttgaaattttccttt |
31132752 |
T |
 |
| Q |
110 |
tcttgtctc |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
31132753 |
tcttgtctc |
31132761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 193 - 260
Target Start/End: Original strand, 31132836 - 31132902
Alignment:
| Q |
193 |
atggaaatctttttaatttgaatttggtgttggtgtgtggattcatactgttttgcattcagctaagc |
260 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31132836 |
atggaaatctttt-aatttgaattgggtgttggtgtgtggattcatacttttttgcattcagctaagc |
31132902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University