View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15275_low_14 (Length: 242)

Name: NF15275_low_14
Description: NF15275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15275_low_14
NF15275_low_14
[»] chr1 (2 HSPs)
chr1 (1-136)||(50936039-50936174)
chr1 (169-221)||(50935973-50936024)


Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 50936174 - 50936039
Alignment:
1 atcttttacattacaaaatgtaacaactttttgtaaaatgcaaattcaatcaatccaaccggtgcacggaaagatcatacagagcagatcaagttttcaa 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50936174 atcttttacattacaaaatgtaataactttttgtaaaatgcaaattcaatcaatccaaccggtgcacggaaagatcatacagagcagatcaagttttcaa 50936075  T
101 taacttagtacttctctctttggatttttgaatttt 136  Q
    ||||||||||||||||||||||||||||||||||||    
50936074 taacttagtacttctctctttggatttttgaatttt 50936039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 50936024 - 50935973
Alignment:
169 gtttctcaatacacttttctgtttttcagactgctgttctactttggatgcct 221  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
50936024 gtttctca-tacacttttctgtttttcagactgctgttctactttggatgcct 50935973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University