View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15275_low_14 (Length: 242)
Name: NF15275_low_14
Description: NF15275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15275_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 50936174 - 50936039
Alignment:
| Q |
1 |
atcttttacattacaaaatgtaacaactttttgtaaaatgcaaattcaatcaatccaaccggtgcacggaaagatcatacagagcagatcaagttttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50936174 |
atcttttacattacaaaatgtaataactttttgtaaaatgcaaattcaatcaatccaaccggtgcacggaaagatcatacagagcagatcaagttttcaa |
50936075 |
T |
 |
| Q |
101 |
taacttagtacttctctctttggatttttgaatttt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50936074 |
taacttagtacttctctctttggatttttgaatttt |
50936039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 50936024 - 50935973
Alignment:
| Q |
169 |
gtttctcaatacacttttctgtttttcagactgctgttctactttggatgcct |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50936024 |
gtttctca-tacacttttctgtttttcagactgctgttctactttggatgcct |
50935973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University