View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_high_27 (Length: 237)
Name: NF15276_high_27
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 22045675 - 22045882
Alignment:
| Q |
14 |
caaaggcaaagtattgattgatatggctgagatatattgacatgacattgggtaagataacattgggacaattaaactttaaaaagattcccatgattat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
22045675 |
caaaagcaaagtattgattgatatggctgagatatattgacatgactttgggtaagataacattgggacaattaaactttcaaaagattcacatgattat |
22045774 |
T |
 |
| Q |
114 |
gtaagggaaatcaaagaatgcaatgataaggaatacttgtgtgcttgagaaaccaaatttgcatgtggcgtgtatttgtgctggtgttatctcttattgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22045775 |
gtaagggaaatcaaagaatgcaatgataaggaatacttgtttgcttgagaaaccaaatttgcatgtgacgtgtatttgtgctggtgttatctcttattgg |
22045874 |
T |
 |
| Q |
214 |
gaaacaaa |
221 |
Q |
| |
|
||||||| |
|
|
| T |
22045875 |
aaaacaaa |
22045882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University