View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_high_3 (Length: 444)
Name: NF15276_high_3
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 15 - 302
Target Start/End: Original strand, 24491239 - 24491526
Alignment:
| Q |
15 |
caaagggagaggaatgatagtagaggtgttgggaggtgtattcaggaattaaggatgaaaggggctagttttgatttgtctaaagagttgcaagtgaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24491239 |
caaagggagaggaatgatagtagaggtgttgggaggtgtattcaggaattaaggatgaaaggggctagttttgatttgtctaaagagttgcaagtgaatg |
24491338 |
T |
 |
| Q |
115 |
ggaaaaggatgaagagttcgagtgttgagattaaatggaaagtggttacttggtttaatcgttatttgcttaccgtttctcttgtttgttttacaggctt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24491339 |
ggaaaaggatgaagagttcgagtgttgagattaaatggaaagtggttacttggtttaatcgttatttgcttactgtttctcttgtttgttttacaggctt |
24491438 |
T |
 |
| Q |
215 |
ggcttttcctgcttccaagtttgttctatgtggtttgtgattgaagattatgatgatgtttggatttgtttattgttgatgatgaggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24491439 |
ggcttttcctgcttccaagtttgttctatgtggtttgtgattgaagattatgatgatgtttggatttgtttattgttaatgatgaggt |
24491526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 429
Target Start/End: Original strand, 24491607 - 24491652
Alignment:
| Q |
384 |
cagcctctctgccaaaggaatgaagcaatgttggtccgattgattt |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24491607 |
cagcctctctgccaaaggaatgaagcaatgttggtccgattgattt |
24491652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University