View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_low_17 (Length: 300)
Name: NF15276_low_17
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 136 - 290
Target Start/End: Original strand, 37914451 - 37914605
Alignment:
| Q |
136 |
ataagtcaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt |
235 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37914451 |
ataagttaaaatatgccatgtgtaaaatgagtggtgccagatgaaggtgattaaatatcgggaaatgatgagacatattttcaagttcaacttactcttt |
37914550 |
T |
 |
| Q |
236 |
tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37914551 |
tctcatctcatttcaaaacaatacaacaacatgagcaacacaaacatgcttcatc |
37914605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 37914153 - 37914186
Alignment:
| Q |
19 |
gagtgaggatgggtggtgaccgatgagcagtgag |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
37914153 |
gagtgaagatgggtggtgaccgatgagcagtgag |
37914186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University