View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_low_24 (Length: 260)
Name: NF15276_low_24
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 241
Target Start/End: Original strand, 10797318 - 10797535
Alignment:
| Q |
24 |
tccctggaaagccgcctccatttccagctgagaaagaagtggaaaccggtgaatgaatcaaatgatttggcatgaaaatgggtgaagaggcagatgaatg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10797318 |
tccctggaaagccgcctccatttccagctgagaaagaagtggaaaccggagaatgaatcaaatgatttggcatgaaaatgggtgcagaggcagaggaatg |
10797417 |
T |
|
| Q |
124 |
attgagcttggaagagaagagtgtgaaaacttcatggcgggctgtgatgatgtagcttggtaaagaagaatggctgtagtggtagaatttggtttgagtg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10797418 |
attgagcttggaagagaagagtgtgaaaacttcatggcgggctgtgatgatgtagcttggtaaagaagaatggctgtagtggtagaatttggtttgagtg |
10797517 |
T |
|
| Q |
224 |
tgagtgtgatgagtgaac |
241 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10797518 |
tgagtgtgatgagtgaac |
10797535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University