View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_low_29 (Length: 246)
Name: NF15276_low_29
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 55208538 - 55208767
Alignment:
| Q |
1 |
tctatgccaacactaagtataacaacaatcaacagagggacgaggttgatcgctttttaatatcacaggttattagttattagttttcccttttcaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208538 |
tctatgccaacactaagtataacaacaatcaacagagcgacgaggttgatcgctttttaatatcacaggttattagttattagttttcccttttcaattt |
55208637 |
T |
 |
| Q |
101 |
taatatacatatgtaatcatcatgttttatatgttactatgattaattggtcgttttttatggtgacagaacgagaaattgagactattgttgcaagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208638 |
taatatacatatgtaatcatcatgttttatatgttactataattaattggtcgttttttatggtgacagaacgagaaattgagactattgttgcaagagc |
55208737 |
T |
 |
| Q |
201 |
agcgaaggacaatattgaagaaggtggaat |
230 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
55208738 |
agcgaaggacaatattgaagaaggtagaat |
55208767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 13135148 - 13135194
Alignment:
| Q |
155 |
tttttatggtgacagaacgagaaattgagactattgttgcaagagca |
201 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
13135148 |
tttttgtggtgacagagcgagaaattgagaatattggtgcaagagca |
13135194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University