View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15276_low_30 (Length: 243)
Name: NF15276_low_30
Description: NF15276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15276_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 37914089 - 37913878
Alignment:
| Q |
17 |
tctctctctccattgcgtgccctcgtaatgcatgtcgtgtctctctaaggagcaagtcctgcgtgagcaaaagcctaaatagaatttatttggacacaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37914089 |
tctctctctccattgcgtgccctcgtaatgcatgtcgtgtctctctaaggagcaagtcctgcgtgagcaaaagcctaaatagaatttatttggacacaca |
37913990 |
T |
 |
| Q |
117 |
tgcatagatacaaacgatattaacttattaactgatgtaacaaatatttttcttttaaattttattatttatgtgtggtgcccccaaaatctttttgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37913989 |
tgcatagatacaaacgatattaacttattaactgatgtaacaaatatttttcttttaaattttattatttatgtgtggtgcccctcaaatctttttgatt |
37913890 |
T |
 |
| Q |
217 |
tagggttgtacc |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37913889 |
tagggttgtacc |
37913878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 26911243 - 26911275
Alignment:
| Q |
161 |
tatttttcttttaaattttattatttatgtgtg |
193 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
26911243 |
tatttatcttttaaattttattatttatgtgtg |
26911275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 32943567 - 32943535
Alignment:
| Q |
161 |
tatttttcttttaaattttattatttatgtgtg |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32943567 |
tatttttcatttaaattttattatttatgtgtg |
32943535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 30785526 - 30785494
Alignment:
| Q |
161 |
tatttttcttttaaattttattatttatgtgtg |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
30785526 |
tatttttcttttaaattttatcatttatgtgtg |
30785494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 17056039 - 17056071
Alignment:
| Q |
161 |
tatttttcttttaaattttattatttatgtgtg |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
17056039 |
tatttttcttttaaattttatcatttatgtgtg |
17056071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 51818448 - 51818416
Alignment:
| Q |
161 |
tatttttcttttaaattttattatttatgtgtg |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
51818448 |
tatttttcttttaaattttatcatttatgtgtg |
51818416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University