View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15277_high_7 (Length: 346)
Name: NF15277_high_7
Description: NF15277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15277_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 22 - 188
Target Start/End: Complemental strand, 16916367 - 16916201
Alignment:
| Q |
22 |
gagggaaccatgaattaggttcgtcttcacagagaaggtctacgccggagaggaagaagcattcgatttcattaggtaagagcactggtcggccattgtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16916367 |
gagggaaccatgaattaggttcgtcttcacagagaaggtctacgccggagaggaagaagcattcgatttcattaggtaagagcactggtcggccattgtc |
16916268 |
T |
|
| Q |
122 |
ggtgaggttcaccggcggtaaggagtttccggccatcggagaagttcagagcttcgacgtcgttttg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16916267 |
ggtgaggttcaccggcggtaaggagtttccggccatcggagaagttcagagcttcgacgtcgttttg |
16916201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 16916086 - 16916037
Alignment:
| Q |
279 |
ctttttacagcttatagagtaaagctcgtcgtgataagcttttatatata |
328 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
16916086 |
ctttttacagcttatagtgtaaagctcgtcgtgataagcgtttatctata |
16916037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 16916200 - 16916155
Alignment:
| Q |
213 |
gagttgaattaaagtgaccttttcaaacaaacaagcttataaattg |
258 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
16916200 |
gagttgaattgaaatgaccttttcaaacaaacaagcttataaattg |
16916155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University