View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15278_high_17 (Length: 238)
Name: NF15278_high_17
Description: NF15278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15278_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 8448864 - 8448650
Alignment:
| Q |
21 |
agacatcaccgaatttgtgtgctacaccgactcacttctttgcttaaacctcattgcaggcccagccatgaattatcacagttatgctgctctcatcgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448864 |
agacatcaccgaatttgtgtgctacaccgactcacttctttgcttaaacctcattgcaggcccagccatgaattatcacagttatgctgctctcatcgat |
8448765 |
T |
 |
| Q |
121 |
gatattacagacctgctgtcatccaacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgattttttggttaagattggagcttcct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448764 |
gatattacagacctgctgtcatccaacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgattttttggttaagattggagcttcct |
8448665 |
T |
 |
| Q |
221 |
atgcttctcctctag |
235 |
Q |
| |
|
|| |||| |||||| |
|
|
| T |
8448664 |
ctgattctgctctag |
8448650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 28046544 - 28046632
Alignment:
| Q |
22 |
gacatcaccgaatttgtgtgctacaccgactcacttctttgcttaaacctcattgcaggcccagccatgaattatcacagttatgctgc |
110 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||| |||||||||||||| |||||| |||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
28046544 |
gacatcactgaatttgtgtgttacaacgactcccttctttgcttaaatctcattacaggaccagccatgaattttcacacttatgctgc |
28046632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 142 - 200
Target Start/End: Complemental strand, 4348842 - 4348784
Alignment:
| Q |
142 |
tccaacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgatttttt |
200 |
Q |
| |
|
|||||||| |||| |||||| |||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
4348842 |
tccaacaacactttaatctttcacactttgcgggagggtaatcaatgcgttgatttttt |
4348784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 206
Target Start/End: Complemental strand, 40557184 - 40557122
Alignment:
| Q |
144 |
caacaatacttcaatcttccacactctgcgggaggg-taaccaatgcgctgattttttggttaa |
206 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
40557184 |
caacaatacttcaatctttcacaca-tgcgggaggggtaaccaatgcgttgattttttgtttaa |
40557122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University