View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15278_low_23 (Length: 205)
Name: NF15278_low_23
Description: NF15278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15278_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 43759703 - 43759498
Alignment:
| Q |
1 |
caggtagatattcttcctagcttagtttttaagtggcattaatgactaatgggcgttacatatacctaataaaaataggaggagtaattggtgggggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43759703 |
caggtagatattcttcctagcttagtttttaagtggcattaatgactaatgggcgttacatatacctaataaaaataggaggagtaattggtgggggtag |
43759604 |
T |
 |
| Q |
101 |
taccctagaagtgatgggcacaagaact-aataactagtactggagctataaaaatgccgttttaaagaaagcgatgagtcgcaacatgaaagggtctaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43759603 |
taccctagaagtgatgggcacaagaactaaataactagtactggagctataaaaatgccgttttaaagaaagcgatgagtcgaaacatgaaagggtctaa |
43759504 |
T |
 |
| Q |
200 |
gagtta |
205 |
Q |
| |
|
|||||| |
|
|
| T |
43759503 |
gagtta |
43759498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University