View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15278_low_8 (Length: 416)

Name: NF15278_low_8
Description: NF15278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15278_low_8
NF15278_low_8
[»] chr5 (3 HSPs)
chr5 (253-350)||(42121047-42121144)
chr5 (192-256)||(42121172-42121237)
chr5 (10-76)||(42121310-42121374)
[»] chr1 (1 HSPs)
chr1 (39-171)||(1919899-1920031)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 8e-34; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 253 - 350
Target Start/End: Complemental strand, 42121144 - 42121047
Alignment:
253 tttggttgagatacagacacttggtagagggtttctagtttgaaaaagtatgctgcaattctgcatagagtgtatcttgattgtggagacacttttag 350  Q
    ||||||||||||||||  |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||    
42121144 tttggttgagatacaggaacttggtagagggtatctagtttgaaaaagtatgctgcaactctgcatagagtgtatcttgttggtggagacacttttag 42121047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 256
Target Start/End: Complemental strand, 42121237 - 42121172
Alignment:
192 tgataattgtattggtagtgaccagataga-tatctaagatttattgtatactctagaatgttttg 256  Q
    |||||||||||||||| |||||||  ||   |||||||||||||||||||||||||||||||||||    
42121237 tgataattgtattggtggtgaccaactaatctatctaagatttattgtatactctagaatgttttg 42121172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 76
Target Start/End: Complemental strand, 42121374 - 42121310
Alignment:
10 aatcataatttttgttttctctgtttctgttacttttcatcactgaagagtgtggcacagctcatag 76  Q
    |||||||| ||||||||||||||||||  ||||||||||||||  |||| |||||||| ||||||||    
42121374 aatcataacttttgttttctctgtttc--ttacttttcatcaccaaagattgtggcacggctcatag 42121310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 39 - 171
Target Start/End: Original strand, 1919899 - 1920031
Alignment:
39 ttacttttcatcactgaagagtgtggcacagctcatagataatcagttcatccatgaaaagcatgatatagatttggaatatcttaagatgacattttct 138  Q
    |||||||||||| |   |||||||||||||||| | ||| |||||||  ||  ||||| ||| |||||| |||||||||||||||| |||||||||| ||    
1919899 ttacttttcatcgccacagagtgtggcacagctgacagagaatcagtatatggatgaagagcttgatattgatttggaatatcttaggatgacatttcct 1919998  T
139 ggtacatctgatgagtaccttgtagatgtctac 171  Q
    |||| |||||||||||  |||||||||||||||    
1919999 ggtatatctgatgagtcacttgtagatgtctac 1920031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University