View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_high_26 (Length: 246)
Name: NF15279_high_26
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_high_26 |
 |  |
|
| [»] scaffold0175 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 32243455 - 32243619
Alignment:
| Q |
1 |
catagaactctccgattaatgcaacatggtggacttggacaattctgtcaatgatactatggccaattctgaaattgtcactgttttaaggactaacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243455 |
catagaactctccgattaatgcaacatggtggacttggacaattctgtcaatgatactatggccaattctgaaattgtcactgttttaaggactaacttg |
32243554 |
T |
 |
| Q |
101 |
ggcttcgttgttgtttttatttatagtcctactaattctatatgtaatttggagtttagatcttt |
165 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243555 |
ggcttcgttgttgtttctatttatagtcctactaattctatatgtaatttggagtttagatcttt |
32243619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0175 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 176
Target Start/End: Complemental strand, 27251 - 27182
Alignment:
| Q |
107 |
gttgttgtttttatttatagtcctactaattctatatgtaatttggagtttagatctttggcatattgat |
176 |
Q |
| |
|
||||||||||| | || || || ||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
27251 |
gttgttgttttgagttttaatcttactaattctatatgtaatttggagtttagaactttgacatattgat |
27182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University