View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_high_27 (Length: 239)
Name: NF15279_high_27
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 13924135 - 13923930
Alignment:
| Q |
13 |
caaaggttaaaatcatgcaaagttgtgggagcatattgctaaacacttaccactcaatatcttaacaataaaagtttatatattcatactacatggcagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13924135 |
caaaggttaaaatcatgcaaagttgtgggagcattttgctaaacattgaccactcaatatcttaacaataaaagtttatatattcatactacatggcagt |
13924036 |
T |
 |
| Q |
113 |
atacaaattccaaatcatgtgtctttgtattggtacataatttataaacatttctaaacccacgacgcagaccctaaaatgtttgatcataattaactag |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13924035 |
atacaaattccaaatcatgtgtctttgcattggtacataatttataaacatttctaaaccc---acgcagaccctaaaaaatttgatcataattaactag |
13923939 |
T |
 |
| Q |
213 |
gcttgtgta |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
13923938 |
gcttgtgta |
13923930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University