View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15279_high_37 (Length: 203)

Name: NF15279_high_37
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15279_high_37
NF15279_high_37
[»] chr6 (1 HSPs)
chr6 (13-177)||(20841168-20841332)


Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 177
Target Start/End: Original strand, 20841168 - 20841332
Alignment:
13 ccattaaaacaacatgagcttcttctctcgaagctagtcttgtaagtaacttatcgacgtctttctcttgttcgcgcgtcagaaacttgaatggcgggag 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20841168 ccatcaaaacaacatgagcttcttctctcgaagctagtcttgtaagtaacttatcgacgtctttctcttgttcgcgcgtcagaaacttgaatggcgggag 20841267  T
113 atactttccacttgtgtctttaatcaagtaaagtggatcgagtataaatgccgctgaccatgcag 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20841268 atactttccacttgtgtctttaatcaagtaaagtggatcgagtataaatgccgctgaccatgcag 20841332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University