View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_high_37 (Length: 203)
Name: NF15279_high_37
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_high_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 177
Target Start/End: Original strand, 20841168 - 20841332
Alignment:
| Q |
13 |
ccattaaaacaacatgagcttcttctctcgaagctagtcttgtaagtaacttatcgacgtctttctcttgttcgcgcgtcagaaacttgaatggcgggag |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20841168 |
ccatcaaaacaacatgagcttcttctctcgaagctagtcttgtaagtaacttatcgacgtctttctcttgttcgcgcgtcagaaacttgaatggcgggag |
20841267 |
T |
 |
| Q |
113 |
atactttccacttgtgtctttaatcaagtaaagtggatcgagtataaatgccgctgaccatgcag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20841268 |
atactttccacttgtgtctttaatcaagtaaagtggatcgagtataaatgccgctgaccatgcag |
20841332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University