View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_high_6 (Length: 519)
Name: NF15279_high_6
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 387; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 20 - 503
Target Start/End: Complemental strand, 46670361 - 46669878
Alignment:
| Q |
20 |
gtcgacaacacttaccttctattctcagcttaacttgtttttgccatgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacacca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46670361 |
gtcgacaacacttaccttctattctcagcttaccttgtttttgccatgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacacta |
46670262 |
T |
|
| Q |
120 |
tgaacattatgttaaccaatgttcttgatgccgcaataggtggtannnnnnnctatgtttttggttttgccctagcttttggaacaccttcaaacggttt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46670261 |
tgaacattatgttaaccaatgttcttgatgccgcaataggtggtatttttttctatgtttttggttttgccctagcttttggaacaccttcaaacggttt |
46670162 |
T |
|
| Q |
220 |
cataggaaaacannnnnnnggtcttactgatttcccttcacaatcttttgattacggnnnnnnnnnnnnncaatgggcttttgccattgccgcagcaggg |
319 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
46670161 |
cataggaaaacatttttttggtcttactgatttcccttcacaatcttttgattacggttttttcctctttcaatgggcttttgccattgctgcagcaggg |
46670062 |
T |
|
| Q |
320 |
atcacaagtggatcaattgctgagagaacacagttcgtttcttatttgatttattcgttgtttttaaccggtttagtttatccaattgttgctcattggt |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46670061 |
atcacaagtggatcaattgctgagagaacacagttcgtttcttatttgatttattcgtcgtttttaaccggtttagtttatccaattgttgctcattggt |
46669962 |
T |
|
| Q |
420 |
tttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttctggtgttattgattttgctggttgtg |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46669961 |
tttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttctggtgttattgattttgctggttgtg |
46669878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 23 - 503
Target Start/End: Complemental strand, 39642161 - 39641681
Alignment:
| Q |
23 |
gacaacacttaccttctattctcagcttaacttgtttttgccatgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacaccatga |
122 |
Q |
| |
|
|||||||| |||||||| ||||| |||| |||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
39642161 |
gacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactcggttttgccatgctttgtgcaggttccgttcgtgccaaaaacaccatga |
39642062 |
T |
|
| Q |
123 |
acattatgttaaccaatgttcttgatgccgcaataggtggtannnnnnnctatgtttttggttttgccctagcttttggaacaccttcaaacggtttcat |
222 |
Q |
| |
|
| |||||||||||||||||||||||||| || | ||| || | |||| |||| || |||||| | ||||| || |||||||| || |||||||| |
|
|
| T |
39642061 |
atattatgttaaccaatgttcttgatgcagccacaggcggcatctttttctatattttcgggtttgcctttgctttcggcacaccttctaatggtttcat |
39641962 |
T |
|
| Q |
223 |
aggaaaacannnnnnnggtcttactgatttcccttcacaatcttttgattacggnnnnnnnnnnnnncaatgggcttttgccattgccgcagcagggatc |
322 |
Q |
| |
|
|||||||| ||||||| |||||| ||||| || ||||||||||| || |||||||||||||| ||||| ||||||| ||| |
|
|
| T |
39641961 |
tggaaaacattttttcggtcttagtgattttccttctcagtcttttgattatggatattttctatatcaatgggcttttgcaattgcttcagcaggaatc |
39641862 |
T |
|
| Q |
323 |
acaagtggatcaattgctgagagaacacagttcgtttcttatttgatttattcgttgtttttaaccggtttagtttatccaattgttgctcattggtttt |
422 |
Q |
| |
|
|| ||||| |||||||||||||||||||| || |||||||||||||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
39641861 |
actagtggttcaattgctgagagaacacaatttgtttcttatttgatttattcgtcttttctaacaggtttagtttatccgattgttgctcattggtttt |
39641762 |
T |
|
| Q |
423 |
ggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttctggtgttattgattttgctggttgtg |
503 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39641761 |
ggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttccggtgttattgattttgctggttgtg |
39641681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 23 - 231
Target Start/End: Complemental strand, 17091438 - 17091230
Alignment:
| Q |
23 |
gacaacacttaccttctattctcagcttaacttgtttttgccatgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacaccatga |
122 |
Q |
| |
|
|||||||| || ||| ||||||||||||| ||||| || | |||||||| |||||||| ||||| ||||| ||||| |||||||| || |||||||||| |
|
|
| T |
17091438 |
gacaacacctatcttttattctcagcttaccttgtcttctctatgcaacttggttttgccatgctctgtgctggttcagttcgtgctaagaacaccatga |
17091339 |
T |
|
| Q |
123 |
acattatgttaaccaatgttcttgatgccgcaataggtggtannnnnnnctatgtttttggttttgccctagcttttggaacaccttcaaacggtttcat |
222 |
Q |
| |
|
|||| ||| | || |||||||| || ||||| || ||| |||| | || ||||||||| | || || |||||||||||||| |||||||| |
|
|
| T |
17091338 |
acatcatgctcacaaatgttctcgacgccgctgctggcggtgttttctactatctcttcggttttgcctttgccttcggaacaccttcaaatggtttcat |
17091239 |
T |
|
| Q |
223 |
aggaaaaca |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
17091238 |
aggaaaaca |
17091230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 23 - 147
Target Start/End: Complemental strand, 35416432 - 35416308
Alignment:
| Q |
23 |
gacaacacttaccttctattctcagcttaacttgtttttgccatgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacaccatga |
122 |
Q |
| |
|
|||||||| |||||||| ||||||||||| | || ||||||||||| || ||||| |||||||| || || || || ||||| ||||||||||| |||| |
|
|
| T |
35416432 |
gacaacacctaccttctcttctcagcttatttagtctttgccatgcagcttggtttcgctatgctctgcgctggctccgttcgagccaaaaacactatga |
35416333 |
T |
|
| Q |
123 |
acattatgttaaccaatgttcttga |
147 |
Q |
| |
|
|||| ||| | |||||||| ||||| |
|
|
| T |
35416332 |
acatcatgctcaccaatgtccttga |
35416308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 35416072 - 35416015
Alignment:
| Q |
383 |
ttaaccggtttagtttatccaattgttgctcattggttttggtctgctgatggttggg |
440 |
Q |
| |
|
||||||||||| |||||||| || ||| | |||||| ||||||| ||||||||||||| |
|
|
| T |
35416072 |
ttaaccggttttgtttatcccatcgtttcgcattgggtttggtccgctgatggttggg |
35416015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 65 - 150
Target Start/End: Complemental strand, 25545169 - 25545084
Alignment:
| Q |
65 |
atgcaactaggttttgctatgctttgtgccggttctgttcgtgccaaaaacaccatgaacattatgttaaccaatgttcttgatgc |
150 |
Q |
| |
|
||||||||||| ||||| ||| | ||||| || ||||| ||||||||||| |||||||||| ||| | |||||||| ||||||| |
|
|
| T |
25545169 |
atgcaactaggctttgccatgatatgtgcaggatctgtccgtgccaaaaatgccatgaacataatgctcaccaatgtagttgatgc |
25545084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University