View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_high_8 (Length: 480)
Name: NF15279_high_8
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_high_8 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 17 - 469
Target Start/End: Complemental strand, 43102649 - 43102197
Alignment:
| Q |
17 |
tcacacatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgcccagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102649 |
tcacacatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgcccagtt |
43102550 |
T |
|
| Q |
117 |
acattagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagttccagctgcctctgcagcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43102549 |
acattagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagtcccagctgcctctgcagcct |
43102450 |
T |
|
| Q |
217 |
ccaacctcttcattgtgttgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcaccggctg |
316 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43102449 |
ccaacctcttcattgtattgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcaccggctg |
43102350 |
T |
|
| Q |
317 |
gaagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggac |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102349 |
gaagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggac |
43102250 |
T |
|
| Q |
417 |
cccaccgtaaccattgcttctatcgggattctaattcaaactacttcattcat |
469 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102249 |
cccaccgttaccattgcttctatcgggattctaattcaaactacttcattcat |
43102197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 383
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
342 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
383 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
351 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
403 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University