View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15279_low_24 (Length: 286)
Name: NF15279_low_24
Description: NF15279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15279_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 9733615 - 9733872
Alignment:
| Q |
1 |
gtttgttggtgagtgacaatg----aaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaacttttt |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733615 |
gtttgttggtgagtgacaatgaatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaacttttt |
9733714 |
T |
|
| Q |
97 |
gaagagttgtttttcacttccttcctttaggtgatgtcgttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacg |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733715 |
gaagagttgtttttctcttccttcctttaggtgatgtctttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacg |
9733814 |
T |
|
| Q |
197 |
ttgttgcttttttctgctcttgtttcataataatgttgcagttcttcacagtgctgtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733815 |
ttgttgcttttttctgctcttgtttcataataatgttgcagttcttcacagtgctgtt |
9733872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University