View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_high_12 (Length: 242)
Name: NF1527_high_12
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_high_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 35030866 - 35031093
Alignment:
| Q |
16 |
ggaatgacgttagtttttccaaaagcgcatttgcacaatgaagtgatttttagaagctggtaatatgagcttttgcgttaatgcctggttttgtgtgatt |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35030866 |
ggaatcacgttagtttttccaaaagcgcatttacacaatgtagtgaattttagaagctcgtaatatgagcttttgcgttaatgcttggttttgtgtgatt |
35030965 |
T |
|
| Q |
116 |
ttgg-aaaaacatggattacaaccgaatatccaaatagaggctttgtaagattgactttcatgattgtttggtttcactttttaaga-tgtcaaaagtgt |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35030966 |
ttggaaaaaacatggattacaaccgaatatccaaatagaggctttgt-agattgactttcatgattgtttggtttcactttttaagattgtcaaaagtgt |
35031064 |
T |
|
| Q |
214 |
aaaaatttatttgaaagaatttttctctc |
242 |
Q |
| |
|
|||| ||||||||||||||||||| |||| |
|
|
| T |
35031065 |
aaaattttatttgaaagaatttttttctc |
35031093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 37958206 - 37958242
Alignment:
| Q |
16 |
ggaatgacgttagtttttccaaaagcgcatttgcaca |
52 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
37958206 |
ggaatgacgttagtttttccaaaagcacatctgcaca |
37958242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University