View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_high_15 (Length: 228)
Name: NF1527_high_15
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 38438385 - 38438588
Alignment:
| Q |
18 |
acaattattaatcttaaggaaa-ttattgaataaacaaattgattggtatgagaatgacatcaatctttttaggtaatgatgataagtggtgtgggttcc |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38438385 |
acaattattaatcttaaggaaaattattgaataaacaaattgattggtatgagaatgacatcaatctttttaggtaatgatgatacgtggtgtgggttcc |
38438484 |
T |
|
| Q |
117 |
tctttgatagttgctgatatagcaaaccaccgactcagaatgcatcacctaaaatagcagtggggttggcactctcatattggtgtctaatattcatctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38438485 |
tctttgatagttgctgatatagcaaaccaccgactcagaatgcatcaactaaaatagcagtggggttggcactctcatattggtgtctaatattcatatc |
38438584 |
T |
|
| Q |
217 |
actc |
220 |
Q |
| |
|
|||| |
|
|
| T |
38438585 |
actc |
38438588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University