View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_10 (Length: 294)
Name: NF1527_low_10
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 279
Target Start/End: Original strand, 12682744 - 12683007
Alignment:
| Q |
16 |
actgactcatggtccaagccaggaccggacgaaaccatttaacacctctagtcacaaaaactcaaagtcatcgaagtattttcctcatattagtggcctc |
115 |
Q |
| |
|
|||| ||||||| || ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12682744 |
actggctcatggctcaggccaggaccagacgaaaccatttaacaccactagtcacaaaaactcaaagtcatcgaagtattttcctcgtattagtggcctc |
12682843 |
T |
|
| Q |
116 |
attcttagcattgtcatgagtgttacatgtctcattcttaggattgtcatgagcgttacatggctacgtgcaaagccccctcttaccaaatttaaaataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682844 |
attcttagcattgtcatgagtgttacatgtctcattcttaggattgtcatgagcgttccatggctacgtgcaaagccccctcttaccaaatttaaaataa |
12682943 |
T |
|
| Q |
216 |
cgcatgcataaacataacaacaaactcaaaataaacattaattatacgatagctgtgtgtgtat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682944 |
cgcatgcataaacataacaacaaactcaaaataaacattaattatacgatagctgtgtgtgtat |
12683007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University