View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_14 (Length: 269)
Name: NF1527_low_14
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 171 - 254
Target Start/End: Original strand, 18099433 - 18099517
Alignment:
| Q |
171 |
aggagaaggtcttcaataagattaagatttgaaattgtcctttccatatgaacttc-aaatataggttgggtatttgaaccttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18099433 |
aggagaaggtcttcaataagattaagatttgaaattgtcctttccatatgaacttcaaaatataggttgggtatttgaaccttgt |
18099517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University