View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_18 (Length: 233)
Name: NF1527_low_18
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 4520700 - 4520494
Alignment:
| Q |
8 |
gagtagcaaagggagaaggagacttttaatttcttcaattttcttcgtgccttccttgctagtcattgttcccttttattgaaggttaagagaatattcc |
107 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4520700 |
gagtaccaaaggaagaaggagacttttaatttcttcagttttcttcgtgccttccttgctagtcattgttcccttttattgaaggttaagagaatattcc |
4520601 |
T |
 |
| Q |
108 |
catctgcaagacgtagaaggcatcnnnnnnnatgcagaaatccccatctgtccaacaactcatatcgaatggggaggtggtgttcatactaaactgtatt |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4520600 |
catctgcaagacgtagaaggcatccggggggatgcagaaatccccatctgtccaacaactcatatcgaatggggaggtggtgttcatactaaactgtatt |
4520501 |
T |
 |
| Q |
208 |
tgtgcac |
214 |
Q |
| |
|
||||||| |
|
|
| T |
4520500 |
tgtgcac |
4520494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University