View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1527_low_19 (Length: 228)

Name: NF1527_low_19
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1527_low_19
NF1527_low_19
[»] chr2 (1 HSPs)
chr2 (18-220)||(38438385-38438588)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 38438385 - 38438588
Alignment:
18 acaattattaatcttaaggaaa-ttattgaataaacaaattgattggtatgagaatgacatcaatctttttaggtaatgatgataagtggtgtgggttcc 116  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
38438385 acaattattaatcttaaggaaaattattgaataaacaaattgattggtatgagaatgacatcaatctttttaggtaatgatgatacgtggtgtgggttcc 38438484  T
117 tctttgatagttgctgatatagcaaaccaccgactcagaatgcatcacctaaaatagcagtggggttggcactctcatattggtgtctaatattcatctc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||    
38438485 tctttgatagttgctgatatagcaaaccaccgactcagaatgcatcaactaaaatagcagtggggttggcactctcatattggtgtctaatattcatatc 38438584  T
217 actc 220  Q
    ||||    
38438585 actc 38438588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University