View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1527_low_21 (Length: 219)

Name: NF1527_low_21
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1527_low_21
NF1527_low_21
[»] chr6 (2 HSPs)
chr6 (1-203)||(6270704-6270905)
chr6 (79-120)||(6278463-6278504)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 6270905 - 6270704
Alignment:
1 gaatttgaattgcttcaatttaggtgattatgcaattttcaatctgaatcaacgtattaaaattagacgaccaacctgatttatcaaagttgaaaagtcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6270905 gaatttgaattgcttcaatttaggtgattatgcaattttcaatctgaatcaacgtattaaaattagacgaccaacctgatttatcaaagttgaaaagtcg 6270806  T
101 atcgttcaatactaatctaacagtctagattgtatgattgcgtcaatattttattttttgtaaggagtggatttatttaaatgaaagactagatattgat 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6270805 atcgttcaatactaatctaacagtctagattgtatgattacgtcaatatttt-ttttttgtaaggagtggatttatttaaatgaaagactagatattgat 6270707  T
201 aat 203  Q
    |||    
6270706 aat 6270704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 79 - 120
Target Start/End: Complemental strand, 6278504 - 6278463
Alignment:
79 atttatcaaagttgaaaagtcgatcgttcaatactaatctaa 120  Q
    ||||||| ||||| ||||||||||||| ||||||||||||||    
6278504 atttatcgaagttaaaaagtcgatcgtccaatactaatctaa 6278463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University