View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_26 (Length: 207)
Name: NF1527_low_26
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 56097648 - 56097829
Alignment:
| Q |
15 |
aatatgatcataatacataatacaaggatctgtctgtctgt----ctccactattaccaccttttacgcctttttatctgtctgtcttctttcactcttt |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56097648 |
aatatgatcataatgcataatacaaggatctgtctgtttgtatgtctccactattaccaccttttacgcctttttatctgtctgtcttctttcactcttt |
56097747 |
T |
 |
| Q |
111 |
caagccaacccaattagatacttctgttttggatagatataacagtaaatttaatagccacttattgatgagtaacaataag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56097748 |
caagccaacccaattagatacttctgttttggatagatataacagtaaatttaatagccacttattgatgagtaacaataag |
56097829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University