View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_27 (Length: 201)
Name: NF1527_low_27
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 10 - 183
Target Start/End: Complemental strand, 39979450 - 39979279
Alignment:
| Q |
10 |
gaggagcagcacagaacattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagc |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979450 |
gaggagcagaacagaacattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagc |
39979351 |
T |
|
| Q |
110 |
catgctagtccatcatcgactaaattgtgaaaattctgatgagctagctacaaaacatagtagtgtatgattgc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39979350 |
catgctagtccatcatcgactaaattgtgaaaattctgatgagct--ctacaaaacatagtagtgtatgattgc |
39979279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University