View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1527_low_5 (Length: 389)
Name: NF1527_low_5
Description: NF1527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1527_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 100 - 380
Target Start/End: Original strand, 25988771 - 25989054
Alignment:
| Q |
100 |
tgtgattacacttggaatcagatttctatgcattgctaggatgctgaatgcatagttttttatatgatacatatagagttatatgatatcttttggtatg |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25988771 |
tgtgatcacacttggaatcagatttctatgcattgctaggatgctgaatgcatagttttttatatgatacatatagagttatatgatgtcttttggtatg |
25988870 |
T |
 |
| Q |
200 |
gatcacttgaaaaatgatagggaaagatgtttcctagtcataaatttgaatagatgtttgtaacctatgtagtatcgacacttcagatcgaag---tatc |
296 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25988871 |
gatcacttaaaaaatgatagggaaagatgtttcctagtcataaatttgaatagatgtttgtaacctatgtagtatcgacacttcagatcgaagacatatc |
25988970 |
T |
 |
| Q |
297 |
tgggttttgacattcatcggagttgcattcaatctttttactttctcggattattattggcgatgttcggtgtttgtgtctgtg |
380 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25988971 |
tgggttttgacattcatcggagttacattcaatctttttactttctcggattattattggtgatgttcggtgtttgtgtctgtg |
25989054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University