View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15280_low_18 (Length: 344)
Name: NF15280_low_18
Description: NF15280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15280_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 23 - 333
Target Start/End: Complemental strand, 19781872 - 19781562
Alignment:
| Q |
23 |
gttcactggcagccggtcaccatgtcgtggtctcatggtgacaagccaaggattcattgcagcttcccatgtgtcctcgaacacagggacgggctcgatc |
122 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781872 |
gttcactggtagccggtcaccatgtcgcggtctcatggtgacaagccaaggattcattgcagcttcccatgtgtcctcgaacacagggacgggctcgatc |
19781773 |
T |
 |
| Q |
123 |
catatttacaattggcacactccaaccgtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctctttg |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781772 |
catatttacaattggcacactccaacggtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctctttg |
19781673 |
T |
 |
| Q |
223 |
caggtggcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781672 |
caggtggcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatct |
19781573 |
T |
 |
| Q |
323 |
tagtgatgatg |
333 |
Q |
| |
|
||||||||||| |
|
|
| T |
19781572 |
tagtgatgatg |
19781562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University