View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15280_low_23 (Length: 277)
Name: NF15280_low_23
Description: NF15280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15280_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 28 - 212
Target Start/End: Complemental strand, 45594889 - 45594705
Alignment:
| Q |
28 |
cagtcataactcataattgtgtgagtaccttcaaatttgttgcaattgtccttgaaaacaactcaatctcaatcccgtcttaaataaacctggtcgtagt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
45594889 |
cagtcataactcataattgtgtgagtaccttaaaatttgttgcaattgtccttgaaaacaactcaatctcaatcccgtcttaaatagacctggtagtagt |
45594790 |
T |
|
| Q |
128 |
tgacttgtagagcatcgggtttgtgtgtctagggacgatggattagggtctaatgaatgtcccttgctctccctgccttgagatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45594789 |
tgacttgtagagcatcgggtttgtgtgtctagggacgatgggttagggtctaatgaacgtcccttgctctccctgccttgagatt |
45594705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University