View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15281_high_10 (Length: 236)
Name: NF15281_high_10
Description: NF15281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15281_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 3703467 - 3703578
Alignment:
| Q |
1 |
attaaagttgctctaaagacaaagaaacccaattactatacgtttgatgtggactatgtcagagctggtgagtttcttttttgtgtatgagtgatttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
3703467 |
attaaagttgctctaaagacaaagaaactcaattactatacgtttgatgtggactatgtcagagctggtgagtttc----ttgtgtttgagagatttgtc |
3703562 |
T |
 |
| Q |
101 |
aaaacttctgaggaac |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3703563 |
aaaacttctgaggaac |
3703578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 3698680 - 3698740
Alignment:
| Q |
161 |
tgccgcagcttccattgcaaggaagatctacttgaggggtggactcggtgttggtgcattc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3698680 |
tgccgcagcttccattgcaaggaagatctacttgaggggtggactcggtgttggtgcattc |
3698740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 3703628 - 3703684
Alignment:
| Q |
165 |
gcagcttccattgcaaggaagatctacttgaggggtggactcggtgttggtgcattc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703628 |
gcagcttccattgcaaggaagatctacttgaggggtggactcggtgttggtgcattc |
3703684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 112
Target Start/End: Original strand, 3698574 - 3698631
Alignment:
| Q |
53 |
actatgtcagagctggtgagtttcttttttgtgtatgagtgatttgtcaaaacttctgag |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
3698574 |
actatgtcagagctggtgagtttc--ttttgtgtttgagtgatttgtcaaaacttttgag |
3698631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University