View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15282_low_2 (Length: 235)
Name: NF15282_low_2
Description: NF15282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15282_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 5042804 - 5042964
Alignment:
| Q |
1 |
attagaaccacaaatagaataagttttactatatctgatgtgagtgacaagctcacacaaacggacatggatttacagctagataattaaacnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5042804 |
attagaaccacaaatagaataagttttactatatctgatgtgagtgacaagctcacacaaacagacatggatttacagctagataattaaacaaaaaagt |
5042903 |
T |
 |
| Q |
101 |
nnnnntcaacaccgtattttttactttgatatgagaaatgatatttgtacaatcatgtaca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5042904 |
aaaaatcaacaccgtattttttactttgatatgagaaatgatatttatacaatcatgtaca |
5042964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 156
Target Start/End: Original strand, 9311034 - 9311063
Alignment:
| Q |
127 |
tgatatgagaaatgatatttgtacaatcat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9311034 |
tgatatgagaaatgatatttgtacaatcat |
9311063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University