View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_high_18 (Length: 245)
Name: NF15283_high_18
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 79 - 233
Target Start/End: Complemental strand, 26609348 - 26609194
Alignment:
| Q |
79 |
gttattgtaatgaaataatttaatccttaaattggtgattaattaatgatttaactaaatgcagggtcctttgctggtcttggttttctttcatggtatt |
178 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609348 |
gttattgtaatgaaatgatttaatccttaaattggtggttaattaatgatttaaccaaatgtagggtcctttgctggtcttggttttctttcatggtatt |
26609249 |
T |
 |
| Q |
179 |
tatcaggaaaagttagagtgtttgatcgtaggggccatattggtaaattgagtat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609248 |
tatcaggaaaagttagagtgtttgatcgtaggggccatattggtaaattgagtat |
26609194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 137 - 220
Target Start/End: Complemental strand, 49474196 - 49474113
Alignment:
| Q |
137 |
atgcagggtcctttgctggtcttggttttctttcatggtatttatcaggaaaagttagagtgtttgatcgtaggggccatattg |
220 |
Q |
| |
|
|||||||||| ||||||||||||| || ||| || |||||| |||| ||||||||||| ||||||||||| || ||||| |||| |
|
|
| T |
49474196 |
atgcagggtcttttgctggtcttgtttatctctcttggtatctatccggaaaagttagggtgtttgatcgcagaggccacattg |
49474113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University