View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_high_20 (Length: 235)
Name: NF15283_high_20
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 135 - 174
Target Start/End: Original strand, 3775281 - 3775320
Alignment:
| Q |
135 |
tatttaagaatactatagtgactttgagtcacccttatta |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775281 |
tatttaagaatactatagtgactttgagtcacccttatta |
3775320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 34671659 - 34671703
Alignment:
| Q |
9 |
gagggtgtaggaatgggggtggggagttggttggttgataatatt |
53 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
34671659 |
gagggtgttggaatgggagtggggagttgattggttgatagtatt |
34671703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University