View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_high_21 (Length: 231)
Name: NF15283_high_21
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 4534928 - 4534725
Alignment:
| Q |
10 |
agcagcacagaatccatttttgggaagaagagagaaagcattggaatggtttaacaactcatcaccaaaagcccagtaaacggcaacagctgaaggaatc |
109 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4534928 |
agcatcacggaatccatttttgggaagaagagagaaagcattggaatggtttaacaattcatcaccaaaagcccagtaaacggcaacagctgaaggaatc |
4534829 |
T |
 |
| Q |
110 |
gttaatgtgaaaacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaatgtaaacgtgtgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4534828 |
gttaatgtgaaaacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaatgcaaacgtgtgt |
4534729 |
T |
 |
| Q |
210 |
gtat |
213 |
Q |
| |
|
|||| |
|
|
| T |
4534728 |
gtat |
4534725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 24628875 - 24628700
Alignment:
| Q |
21 |
atccatttttgggaagaagagagaaagcattggaatggtttaacaactcatcaccaaaagcccagtaaacggcaacagctgaaggaatcgttaatgtgaa |
120 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||||||| | | ||||| ||||| ||||| ||||| ||| || |||||||||||||||||||| |
|
|
| T |
24628875 |
atccatttttaggtaggagagagaaagcattggaatggttaagaagttcatctccaaaggcccaataaacagcagtggcagaaggaatcgttaatgtgaa |
24628776 |
T |
 |
| Q |
121 |
aacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaa |
196 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||| || |||||||| || |||||||||||||||||| |
|
|
| T |
24628775 |
aacgtataaagttgccatcaaatatatgtacttgaatttttgtggcttccacatggcgtgcataatctctctgcaa |
24628700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University