View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_low_17 (Length: 247)
Name: NF15283_low_17
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 228
Target Start/End: Complemental strand, 44314584 - 44314375
Alignment:
| Q |
10 |
tagcataggaaagtccaagaatgaggaatctctttgtgagaaatcaatgaaggttgtagtaaatgtcataaggttatcctctttctctattgcacaaagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314584 |
tagcataggaaagtccaagaatgaggaatctctttgtgagaaatcaatgaaggttgtagtaaatgtcataaggttatcctctttctctattgcacaaagg |
44314485 |
T |
|
| Q |
110 |
acccttggagttggagcttctactactagaaaatcaaggaaggataaggatctttcagattctgattattctgagaaggaacctatgaaggaaaaattgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44314484 |
acccttggagttggagcttctactactagaaaatcaaggaaggataaggatctttcagatt---------ctgagaaggaacctatgaaggaaaaattgg |
44314394 |
T |
|
| Q |
210 |
tttctaataagcaatttcc |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44314393 |
tttctaataagcaatttcc |
44314375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University