View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15283_low_19 (Length: 245)

Name: NF15283_low_19
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15283_low_19
NF15283_low_19
[»] chr8 (1 HSPs)
chr8 (18-234)||(29607447-29607663)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 29607447 - 29607663
Alignment:
18 cacagaatggtgcacaatcttaccaagggcaatggagaaagatgttggcaactggtggaattgctattgccattttgttatgtgtcacttgagtaactgc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29607447 cacagaatggtgcacaatcttaccaagggcaatggagaaagatgttggcaactggtggaattgctattgccattttgttatgtgtcacttgagtaactgc 29607546  T
118 agaagatgctcatatgacaaaacatggattcgagcgaaacggttatttggtttgcaaaaatataaaattatttcatatgtatggaattgaatgatgaaca 217  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29607547 agaagatgctcatatgacaaaacatggattcaagcgaaacggttatttggtttgcaaaaatataaaattatttcatatgtatggaattgaatgatgaaca 29607646  T
218 attatactcataatatt 234  Q
    |||||||||||||||||    
29607647 attatactcataatatt 29607663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University