View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_low_2 (Length: 481)
Name: NF15283_low_2
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 419 - 467
Target Start/End: Original strand, 27817115 - 27817163
Alignment:
| Q |
419 |
cgtatcacgcatattgttagactgtgttcatcgttcattttttcatatc |
467 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27817115 |
cgtatcacacctattgttaaactgtgttcatcgttcattttttcatatc |
27817163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University