View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_low_22 (Length: 230)
Name: NF15283_low_22
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 30917963 - 30917858
Alignment:
| Q |
1 |
ttttaattgattttatttaatttaaatttgtaccttgctttacatcttaagaaaactataacagtgttggcttggattatatatgtgaaaaaccattttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
30917963 |
ttttaattgattttatttaatttaaatttgtaccttgctttgcatcttaagaaaactataacagtgttggcttgcattatacatgttgaaaaccattttt |
30917864 |
T |
|
| Q |
101 |
tcatga |
106 |
Q |
| |
|
|||||| |
|
|
| T |
30917863 |
tcatga |
30917858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 30917759 - 30917726
Alignment:
| Q |
184 |
tttgtttttcatattttcatatctttatcatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30917759 |
tttgtttttcatattttcatatctttatcatttc |
30917726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University