View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15283_low_6 (Length: 416)
Name: NF15283_low_6
Description: NF15283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15283_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 287 - 399
Target Start/End: Complemental strand, 30129066 - 30128954
Alignment:
| Q |
287 |
atgacaatgcataaagcaactaatccacaaaccatggatttctcatgaagtcgcttatgttcacctaaccaaaacttttaccttgtcaatcaagccttaa |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30129066 |
atgacaatgcataaagcaactaatccacaaaccatggatttctcatgaagtcgcttatgttcacctaaccaaaacttttaccttgtcaatcaagccttaa |
30128967 |
T |
 |
| Q |
387 |
tcaattgggagct |
399 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30128966 |
tcaattgggagct |
30128954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 185 - 290
Target Start/End: Complemental strand, 30129890 - 30129785
Alignment:
| Q |
185 |
atataaatgtataattattgctgaaacctttatttaattttggttttaggaaagtaacagcagatctatttaaaaattgagtaatagtcaataataccat |
284 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
30129890 |
atataaatgtataattattgttgaaacctttatttaattttggttttaggaaagtaacagcagatctatgtaaaaattgagtaatagtcaacaataccat |
30129791 |
T |
 |
| Q |
285 |
ggatga |
290 |
Q |
| |
|
|||||| |
|
|
| T |
30129790 |
ggatga |
30129785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 144 - 177
Target Start/End: Complemental strand, 30129890 - 30129857
Alignment:
| Q |
144 |
atataaatgtataattattgttgaaacctttatt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30129890 |
atataaatgtataattattgttgaaacctttatt |
30129857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University