View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15284_high_17 (Length: 276)
Name: NF15284_high_17
Description: NF15284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15284_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 27019351 - 27019593
Alignment:
| Q |
1 |
gtatggtatgcattctagtattgtttgtccaatgatgctggtttcttttgttttccagtcgaccaaaagttttgattatcatgtctcattttctctaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27019351 |
gtatggtatgcattctagtattgtttgtccaatgatgctggtttcttttgttttccagtcgaccaaaagttttgattatcatgtctcattttctctaact |
27019450 |
T |
|
| Q |
101 |
attttaattgtgcaaactttgttttcctcggtatcttccttgtatgtatgcccgagagcatggtaagacgatgcttcaccagacagatatagtggaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27019451 |
attttaattgtgcaaactttgttttcctcggtatcttccttgtatgtatgcccgagagcatggtaagacgatgcttcaccagatagatatagtggaaaat |
27019550 |
T |
|
| Q |
201 |
gtggttaacttcctattattagctcctaaagagatacccaaatt |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27019551 |
gtggttaactt-ctattattagctcctaaagagatacccaaatt |
27019593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University