View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15284_high_2 (Length: 583)
Name: NF15284_high_2
Description: NF15284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15284_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 496; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 496; E-Value: 0
Query Start/End: Original strand, 19 - 569
Target Start/End: Complemental strand, 56442938 - 56442385
Alignment:
| Q |
19 |
gcaaggagtgaggggtgatggcagcagcagcgataggagtgagatgctgctgctcattgtcgtttccgtctcatcgcaaatcttcatcttcttcatgttc |
118 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
56442938 |
gcaaagagtgaggggtgatggcagcagtagcgataggagtgaggtgctgctgctcattgtcgtttccgtctcatcgcaaatcttcatcttcttcatgctc |
56442839 |
T |
 |
| Q |
119 |
tgattattattacagaaaaagaagtagtagaatcaacgcttcttcattgttctggggatcttctaaggacaacaacaaacataataacatttcttcttct |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56442838 |
tgattattattacagaagaagaagtagtagaatcaacgcttcttcattgttctggggatcttctaaggacaacaacaaacagaataacatttcttcttct |
56442739 |
T |
 |
| Q |
219 |
tcttc---atcgcatcagcaacaattcagcttcaatgtgaccaccacaacagaatctgaagaagataaagataagattattactgtttcttttgtatctt |
315 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56442738 |
tcttcttcatcgcatcagcaacaattcagcttcaatgttaccaccacaacagaatctgaagaagataaagataaaattattactgtttcttttgtatctt |
56442639 |
T |
 |
| Q |
316 |
caatttcagatattccatccacccaatgggatgcatgtgctcttgatgctacaggaggaccagacaaattcaatccatttctctcacacgcatttctatc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
56442638 |
caatttcagatattccatccacccaatgggatgcatgtgctcttgatgctactggaggaccagacaagttcaatccatttctctcacacgcttttctatc |
56442539 |
T |
 |
| Q |
416 |
ctctctagaactatcatcttcttctgttaaggaaaagggatggaccccacaccacatcatcgctaaggatattcataatcatattctcgctgttgttcct |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56442538 |
ctctctagaactatcatcttcttctgttaaggaaaagggatggaccccacaccacatcatcgctaaggatattcataatcatattctcgctgttgttcct |
56442439 |
T |
 |
| Q |
516 |
ctctatctcaagacccattcttatggtgaattcgtttttgatcattcttgggcc |
569 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56442438 |
ctctatctcaagacccattcttatggtgaattcgtttttgatcattcttgggcc |
56442385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University