View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15284_low_17 (Length: 298)
Name: NF15284_low_17
Description: NF15284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15284_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 43 - 287
Target Start/End: Original strand, 23918569 - 23918816
Alignment:
| Q |
43 |
ctttccattttctcttatccattatgaccttctttttattcttgaagggtggtgtcagctaggaaggattagttccgtatctcctctttatcaaatcaac |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
23918569 |
ctttccattttctcttatccattatgaccttctttttattcttgaagggtggtgtcagctaggaagggctagttccttatctcctctttatctaatcaac |
23918668 |
T |
|
| Q |
143 |
tccttcgattccgcaaag---gtggtgttgacagggagtctttgacttctccatgttcgcttgagtacatagtgttggctaggagtcttagactgcttca |
239 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23918669 |
tccttcgattccacaaagaaggtggtgttgacagggagtctttgacttctccatgttcgcttgagcacatagtgttggctaggagtcttagactgcttca |
23918768 |
T |
|
| Q |
240 |
cgttcactcgagcacaaagtttctgctaggattctctgacttcttcat |
287 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
23918769 |
cgttcactcgagcacaaggtttctgctaggaggctttgacttcttcat |
23918816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University