View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15284_low_18 (Length: 279)
Name: NF15284_low_18
Description: NF15284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15284_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 9 - 127
Target Start/End: Complemental strand, 39917908 - 39917790
Alignment:
| Q |
9 |
atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccaaatttatagcccaaaatattgggtaagacctctattcaacagtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917908 |
atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccagatttatagcccaaaatattgggtaagacctctattcaacagtc |
39917809 |
T |
|
| Q |
109 |
aaccaccatagcaattagc |
127 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39917808 |
aaccaccatagcaattagc |
39917790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 182 - 279
Target Start/End: Complemental strand, 39917737 - 39917640
Alignment:
| Q |
182 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacagcaacgttaacaactcagctatgctgtga |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39917737 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacaacaacgttaacaactcagctatgctgtga |
39917640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University